View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_97 (Length: 234)
Name: NF7607_low_97
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 13886200 - 13885999
Alignment:
| Q |
19 |
attgtgttcatcactattttctaattagtttaggcttctgttcatagattatatattgaatgttaaataggatatccctaccttttttgagtgttaactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13886200 |
attgtgttcatcactattttctaattagtttaggcttctgttcatatattatatattgaatgttaaataggatatccctaccttttttgagtgttaactt |
13886101 |
T |
|
| Q |
119 |
tccgattttcnnnnnnngtgggtaatactagtaatttgaagttcgcaaaagataagtaaagtctgaaattgaactcaacttttcctaaataatttgtatt |
218 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13886100 |
tccaattttcaagaaaaatgggtaatactagtaatttgaagtttgcgaaagataagtaaagtctgaaattgaactcaacttttcctaaataatttttatt |
13886001 |
T |
|
| Q |
219 |
tt |
220 |
Q |
| |
|
|| |
|
|
| T |
13886000 |
tt |
13885999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University