View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_99 (Length: 228)
Name: NF7607_low_99
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_99 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 74 - 228
Target Start/End: Original strand, 2885997 - 2886151
Alignment:
| Q |
74 |
tatagtcctacactcctagctctttacaagaaaatgtatcgtccaagccatgattgcaattttcaccataatattattttaagtgatttggtgtatgttt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2885997 |
tatagtcctacactcctagctctttacaagaaaatgtatcgtccaagccatgatagcaattttcaccataatattattttaagtgatttggtgtatgttt |
2886096 |
T |
|
| Q |
174 |
gaaataacactgaatttaaaaatttatggtaatatcgtaattttgttttgacact |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886097 |
gaaataacactgaatttaaaaatttatggtaatatcgtaattttgttttgacact |
2886151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 2884638 - 2884703
Alignment:
| Q |
11 |
tttttatcaaacaatacagttatttctatcttttcaaataatccaaacagatgtcatccatattat |
76 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2884638 |
tttttatcgaacaatacagttatttctatcttttcaaataacttaaacagatgtcatccatattat |
2884703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University