View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_18 (Length: 289)
Name: NF7609_high_18
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 44594576 - 44594302
Alignment:
| Q |
18 |
ctcccaatcccacatcactgaaatcatcatcaccagtttcttccgccataagtcttagatctttaatcattcattcctagctagcttgtagctatatacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44594576 |
ctcccaatcccacatcactgaaatcatcatcaccagtttcttccgccataagtcttagatctttaatcattcattcctagctagcttgtagctatatacc |
44594477 |
T |
 |
| Q |
118 |
tattatggcacgttaagatataagaaagnnnnnnnnngtttaactttggttgaatttagctttgtgatcataa------atatatatatggcgggtggga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44594476 |
tattatggcacgttaagatataagaaagaaaaaagaagtttaactttagttgaatttagctttgtgatcataaatttatatatatatatggcgggtggga |
44594377 |
T |
 |
| Q |
212 |
gagttttttcaaatggtcctgcaaatatttcaaatataaatatgaatattttgcttcagaatcaacaccaaactc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44594376 |
gagttttttcaaatggtcctgcaaatatttcaaatataaatatgaatattttgcttcagaatcaacaacaaactc |
44594302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University