View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_21 (Length: 265)
Name: NF7609_high_21
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 205
Target Start/End: Original strand, 45973298 - 45973495
Alignment:
| Q |
9 |
ccatctctaatcttttcactttacacccgcagcacaatatattcaacaaggaaaaacccatgagcttaagcgcatcgttcaggttgagaaaaattggaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973298 |
ccatctctaatcttttcactttacacccgcaacacaatatattcaacaagggaaaacccatgagcttaagcgcatcgttcaggttgagaaaaattggaaa |
45973397 |
T |
 |
| Q |
109 |
cctttgcctaattgatgcgttttatccat-aaggattccaattcattacattgttttccattacaatttaacaatttaccagtgaggggttctttgag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45973398 |
cctttgcctaattgatgcgttttatccatcaaggattccaattcattacattgttttccattacaatttatcaatttaccagtgaggggttctttgag |
45973495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University