View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_22 (Length: 253)
Name: NF7609_high_22
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 30769964 - 30770197
Alignment:
| Q |
13 |
aatatgatcgtatagcatctgcatcttctaccatgaaaccttcatcatcaagactaagagtgttcttgttcttcacaaaaccagagtccacactttcaat |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
30769964 |
aatatgatcgtatagcatcggcatcttctacaatgaaaccttcatcatcaagactaagagtgtttttgttcttcacaaaaccagataccacactttcaat |
30770063 |
T |
|
| Q |
113 |
gggatcacttcttgatgatgcaaaatctgagacatggtttgttgatgcactcaacaactcagggattctctcaagaggtgtgtcagattctgcaggagat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30770064 |
gggatcacttcttgatgatgcaaaatctgagacatggtttgttgatgcactcaacaactcagggattctctcaagaggtgtgtcagattcagcaggagat |
30770163 |
T |
|
| Q |
213 |
tcttttgtgaatcttgataatgttcctgctagtg |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
30770164 |
tcttttgtgaatcttgatagtgttcctgctagtg |
30770197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University