View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_26 (Length: 240)
Name: NF7609_high_26
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 21868764 - 21868524
Alignment:
| Q |
10 |
atcaaactaagttcatcacaacgcaatgcaaaacacataatgtagaaattt-tttaaaatccatcta---------gcaaagcatcaaaatccacaaatt |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21868764 |
atcaaaccaagttcatcacaacgcaatgcaaaacacataatgtagaaatttgtttaaaatccatctcttgtttccggcaaagcatcaaaatccataaatt |
21868665 |
T |
 |
| Q |
100 |
gagtttcccattcctgaccaggtttagcaactggatcatccaaatatgcaacattatcaagtacttgattagcccaatccataaaatcatccaattcttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21868664 |
gagtttcccattcctgaccaggtttagtaactggatcatccaaatatgcaacattatcaagtacttgattagcccaatccataaaatcatccaattcttc |
21868565 |
T |
 |
| Q |
200 |
aacctcacctagtcgattaatatcactaagtggcttcaaat |
240 |
Q |
| |
|
||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21868564 |
aacttcaccaagtcgattagtatcactaagtggcttcaaat |
21868524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University