View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_29 (Length: 239)
Name: NF7609_high_29
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 1357804 - 1358020
Alignment:
| Q |
7 |
gagtgagatgaaattgagccaagaaaatctcaatgaattagctcttgggattgagaattctaaattacctttcttttgggttttgagagatttgaaaaat |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357804 |
gagtgaggtgaaattgagccaagaaaatctcaatgaattagctcttgggattgagaattctaaattacctttcttttgggttttgagagatttgaaaaat |
1357903 |
T |
 |
| Q |
107 |
ggttttgctgagttaccaaatgggtttgaggataggacaaaagatcatggtatagtgtggaaaagttgggccccacaacctaagatcttaggtcatggtt |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357904 |
ggttttgttgagttaccaaatgggtttgaggataggacaaaagatcatggtatagtgtggaaaagttgggccccacaacctaagatcttaggtcatggtt |
1358003 |
T |
 |
| Q |
207 |
cagttggtggttgtttg |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1358004 |
cagttggtggttgtttg |
1358020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University