View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7609_high_29 (Length: 239)

Name: NF7609_high_29
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7609_high_29
NF7609_high_29
[»] chr2 (1 HSPs)
chr2 (7-223)||(1357804-1358020)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 1357804 - 1358020
Alignment:
7 gagtgagatgaaattgagccaagaaaatctcaatgaattagctcttgggattgagaattctaaattacctttcttttgggttttgagagatttgaaaaat 106  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1357804 gagtgaggtgaaattgagccaagaaaatctcaatgaattagctcttgggattgagaattctaaattacctttcttttgggttttgagagatttgaaaaat 1357903  T
107 ggttttgctgagttaccaaatgggtttgaggataggacaaaagatcatggtatagtgtggaaaagttgggccccacaacctaagatcttaggtcatggtt 206  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1357904 ggttttgttgagttaccaaatgggtttgaggataggacaaaagatcatggtatagtgtggaaaagttgggccccacaacctaagatcttaggtcatggtt 1358003  T
207 cagttggtggttgtttg 223  Q
    |||||||||||||||||    
1358004 cagttggtggttgtttg 1358020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University