View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_high_34 (Length: 206)
Name: NF7609_high_34
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_high_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 30770399 - 30770578
Alignment:
| Q |
18 |
atgctggtagcaggcttcaacaagagaacaaagttgtaatgaagcaagatggtgggtttgttgtttcttctgctaatgtggctatggctgcaattcctgc |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770399 |
atgccggtagcaggcttcaacaagagaacaaagttgtaatgaagcaagatggtgggtttgttgtttcttctgctaatgtggctatggctgcaattcctgc |
30770498 |
T |
 |
| Q |
118 |
aacatcaacaatggcttttggtggagttgttgctgctactagtggtgatgttaatgtgaatagggttgtttctgatgatg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770499 |
aacatcaacaatggcttttggtggagttgttactgctactagtggtgatgttaatgtgaatagggttgtttctgatgatg |
30770578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University