View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_low_21 (Length: 286)
Name: NF7609_low_21
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 13 - 101
Target Start/End: Complemental strand, 8287293 - 8287205
Alignment:
| Q |
13 |
aatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8287293 |
aatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag |
8287205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University