View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_low_25 (Length: 255)
Name: NF7609_low_25
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 234
Target Start/End: Complemental strand, 16386041 - 16385827
Alignment:
| Q |
20 |
cacacacagcataaaatttcatcctcatcgacttcaaattcaatgtcctgtttttgagattgtttttcgattggggtgggtgatgggagagaaggactgt |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16386041 |
cacacacagcataaaatttcatcatcatcgacttcaaattcaatgtcctgtttttgagattgtttttcgattggggtggctgatgggagagaaggactgt |
16385942 |
T |
 |
| Q |
120 |
attcgacgttgagatcgatgagcggaacagcgtcgtttgggatgttattgtggtggtgaaggtggggttgaagggcggttattcnnnnnnnggtgggtag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16385941 |
attcgacgttgagatcgatgagcggaacagcatcgtttgggatgttattgtggtggtgaaggtggggttgaagggcggttattctttttttggtgggtag |
16385842 |
T |
 |
| Q |
220 |
agaataagtagatgg |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16385841 |
agaataagtagatgg |
16385827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University