View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7609_low_27 (Length: 248)
Name: NF7609_low_27
Description: NF7609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7609_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 26278947 - 26279169
Alignment:
| Q |
5 |
agttaaattagtacggaggtttgtcaccttaacttgtttatcatggtttttatgcaatgatatcttgta-ta-gtaccaaacagaccaaattattttgca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
26278947 |
agttaaattagtacggaggtttgtcaccttaacttgtttatcatggtttttatgcaatgatatcttgtagtaccaaccaaacagatcaaattattttgca |
26279046 |
T |
 |
| Q |
103 |
tgtggggacgatgtaatgtgtttgctttctagaatgggcaattcttggtttggttttcagttaccagatacatatatagatacaaaatataatctttgtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26279047 |
tgtggggacgatgtaatgtgtttgctttctagaatggacaattcttggtttggttttcagtaaccagatacatatatagatacaaaatataatctttgtt |
26279146 |
T |
 |
| Q |
203 |
tcttggttaattatttgaggcaa |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26279147 |
tcttggttaattatttgaggcaa |
26279169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 5 - 132
Target Start/End: Original strand, 26282184 - 26282313
Alignment:
| Q |
5 |
agttaaattagtacggaggtttgtcaccttaacttgtttatcatggtttttatgcaatgatatcttgta-ta-gtaccaaacagaccaaattattttgca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
26282184 |
agttaaattagtacggaggtttgtcaccttaacttgtttatcatggtttttatgcaatgatatcttgtagtaccaaccaaacagaccaaattattttgca |
26282283 |
T |
 |
| Q |
103 |
tgtggggacgatgtaatgtgtttgctttct |
132 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||| |
|
|
| T |
26282284 |
tgtgggaacgatttaatgtgtttgttttct |
26282313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 172 - 219
Target Start/End: Original strand, 26282681 - 26282728
Alignment:
| Q |
172 |
acatatatagatacaaaatataatctttgtttcttggttaattatttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26282681 |
acatatatagatacaaaatataatctttgtttcttggttaattatttg |
26282728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University