View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7610_high_6 (Length: 242)
Name: NF7610_high_6
Description: NF7610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7610_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 27967335 - 27967100
Alignment:
| Q |
7 |
atggacatcaattaacttgcattgtttatacggcttaaaacattgtctcaacagtgtgccatatttcattgccaatccttcgtcatttatatttgtccat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27967335 |
atggacatcaattaacttgcattgtttatacggctgaaaacattgtctcaacagtgtgccatatttcattgccaatccttcgtcatttatatttgtccat |
27967236 |
T |
|
| Q |
107 |
tcttgatgatatttttggatgggatatttctatcttactgttttcctcatcttcctaaggaccacaggatacctattattgattccagcatgatctgcac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27967235 |
tcttgatgatatttttggatgggatatttctatcttactgttttcctcatcttcctaaggaccacaggatacctattattgattccagcatgatctgcac |
27967136 |
T |
|
| Q |
207 |
gatgttaaattgcagactgtagagtggtctccaccc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27967135 |
gatgttaaattgcagactgtagagtggcctccaccc |
27967100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University