View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7610_low_10 (Length: 209)
Name: NF7610_low_10
Description: NF7610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7610_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 35922600 - 35922420
Alignment:
| Q |
13 |
acctgtgcaatgcaaaggcttctctctctcttctaaatatgtgccccatctctctattttacactttcccatactaatctttgtactcactctaacatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922600 |
acctgtgcaatgcaaaggcttctctctctcttctaaatatgtgccccatctctctattttacactttcccatactaatctttgtactcactctaacatct |
35922501 |
T |
|
| Q |
113 |
cactttttcaaccattgcttccatacttctttctctttatcccacactctctctatccctcttccatccttcagtttctca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922500 |
cactttttcaaccattgcttccatacttctttctctttatcccacactctctctatccctcttccatccttcagtttctca |
35922420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University