View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7610_low_5 (Length: 289)
Name: NF7610_low_5
Description: NF7610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7610_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 42 - 270
Target Start/End: Original strand, 2209150 - 2209390
Alignment:
| Q |
42 |
tggagtacatgcttatgcaaacaatagagctggacattgaccacataaaacaaaaaccatagtagcaaatttttggtatcctatgttgctctcctataaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209150 |
tggagtacatgcttatgcaaacaatagagctggacattgaccacataaaacaaaaaccatagtagcaaatttttggtatcctatgttgctctcctataaa |
2209249 |
T |
 |
| Q |
142 |
agggaggaaggtcttcttcttttgt--------aaaaaaccactacatacattgttt---cacctttcactttgctctctttcatttttgcttacttgtt |
230 |
Q |
| |
|
|||| ||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209250 |
agggtggaaggtcttcttattttgtaaaaaacaaaaaaaccactacatacattgtttcaccacctttcactttgctctctttcatttttgcttacttgtt |
2209349 |
T |
 |
| Q |
231 |
tgctac-tattttctttggttctgatctgagtgttctagat |
270 |
Q |
| |
|
|||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
2209350 |
tgctactttttttttttggttctgatctgagtgttctagat |
2209390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University