View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7612_low_5 (Length: 205)
Name: NF7612_low_5
Description: NF7612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7612_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 50 - 184
Target Start/End: Original strand, 31328262 - 31328396
Alignment:
| Q |
50 |
actaatccaatgaccatttccataagatcctccataactcttacctgaattagatttttgcataggatacaaatttatgttagaccatgatgatgatttt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31328262 |
actaatccaatgaccatttccataagatcctccataactcttacctgaattagatttttgcataggatacaaatttatgttagaccatgatgatgatttt |
31328361 |
T |
 |
| Q |
150 |
gttgttgctgatgatgtttgcttgtttgaactcat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31328362 |
gttgttgctgatgatgtttgcttgtttgaactcat |
31328396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University