View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7612_low_6 (Length: 204)

Name: NF7612_low_6
Description: NF7612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7612_low_6
NF7612_low_6
[»] chr4 (1 HSPs)
chr4 (1-189)||(40348578-40348766)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 40348578 - 40348766
Alignment:
1 attttttgacaagcttattttttattattaaccattgagaagtttataagcagggacatttgtttgcaaaaattcaatcaaaatggtttgatgaaaataa 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40348578 attttttgacaagcttattttttattattaactattgagaagtttataagcagggacatttgtttgcaaaaattcaatcaaaatggtttgatgaaaataa 40348677  T
101 gattaattatcattgatattgatgcaagattattgctttgtgcagaaatcttttgttttttgcacgaatacgagctacaacagtattat 189  Q
     ||||||||||||||||||||||  |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
40348678 tattaattatcattgatattgatataagattattgctttgtgcaggaatcttttgttttttgcacgaatacgagctacaacagtattat 40348766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University