View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7612_low_6 (Length: 204)
Name: NF7612_low_6
Description: NF7612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7612_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 40348578 - 40348766
Alignment:
| Q |
1 |
attttttgacaagcttattttttattattaaccattgagaagtttataagcagggacatttgtttgcaaaaattcaatcaaaatggtttgatgaaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40348578 |
attttttgacaagcttattttttattattaactattgagaagtttataagcagggacatttgtttgcaaaaattcaatcaaaatggtttgatgaaaataa |
40348677 |
T |
 |
| Q |
101 |
gattaattatcattgatattgatgcaagattattgctttgtgcagaaatcttttgttttttgcacgaatacgagctacaacagtattat |
189 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40348678 |
tattaattatcattgatattgatataagattattgctttgtgcaggaatcttttgttttttgcacgaatacgagctacaacagtattat |
40348766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University