View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7613_low_2 (Length: 240)
Name: NF7613_low_2
Description: NF7613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7613_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9453026 - 9453247
Alignment:
| Q |
1 |
caaattgttgaacaacttggacagtaatgcctgcgtagagtcctcttcgaactacgtcattagaccaagcaccctttagtttttgtgcaagactatgacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9453026 |
caaattgttgaacaacttggacagtaatgcctgcgtagagtcctcttcgaactacgtcattagaccaagcaccctttagtttttgtgcaagactatgacc |
9453125 |
T |
 |
| Q |
101 |
gatcaagccttcctctgccttctcggcttcaatggattcatgcatggctttcatctcgtcttcaacttcaccggggcgatagatttttgtcagaataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9453126 |
gatcaagccttcctctgccttctcggcttcaatggattcatgcatggctttcatttcgtctgcaacttcaccggggcgatagatttttgtcagaataatc |
9453225 |
T |
 |
| Q |
201 |
tttgcttcctcctccttgctct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9453226 |
tttgcttcctcctccttgctct |
9453247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 9441799 - 9442016
Alignment:
| Q |
5 |
ttgttgaacaacttggacagtaatgcctgcgtagagtcctcttcgaactacgtcattagaccaagcaccctttagtttttgtgcaagactatgaccgatc |
104 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9441799 |
ttgttgaacaacttggacagtgatgcctgcgtagagtcctcttcgaactacgtcattagaccaggcaccctttagtttttgtgcaagactatggccgatc |
9441898 |
T |
 |
| Q |
105 |
aagccttcctctgccttctcggcttcaatggattcatgcatggctttcatctcgtcttcaacttcaccggggcgatagatttttgtcagaataatctttg |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || || ||||||||||| | |||||| ||||| |
|
|
| T |
9441899 |
aagccatcctctgccttctcggcttcaatggattcatgcatggctttcatctcctcttcaacttctcccggtcgatagattttcgacagaatttgctttg |
9441998 |
T |
 |
| Q |
205 |
cttcctcctccttgctct |
222 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
9441999 |
cttcctcttccttgctct |
9442016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University