View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7614_low_3 (Length: 315)
Name: NF7614_low_3
Description: NF7614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7614_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 6 - 156
Target Start/End: Complemental strand, 38943664 - 38943515
Alignment:
| Q |
6 |
ttttcatattttgaatttcaataactctttcaaaagagaatagccaaattgtttactgttgaaacaccaacttagtgagttcggttttcactcaattgtt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
38943664 |
ttttcatattttgaatttcaataactctttcaaaagagaatagccaaattgttaactgttgaaacaccaatttagtgagttcagttttcactcaattgtt |
38943565 |
T |
|
| Q |
106 |
taacttggttttgtcatattcaattgccttttttccgcaaaaatctgttgt |
156 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
38943564 |
taacttggttttgtcagattcaattgcct-ttttctgcaaaaatctgttgt |
38943515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 155 - 248
Target Start/End: Complemental strand, 38943330 - 38943237
Alignment:
| Q |
155 |
gttgcagataaggcatttgtctataatgtgatgaatataactaggctcttgatcaatcctgacattcaagaggctcttcaattgaagaatgggt |
248 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38943330 |
gttgcatataaggcatttgtgcagaatgtgatgaatataactaggctcttgatcaatcctgacattccagaggctcttcaattgaagaatgggt |
38943237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 300
Target Start/End: Complemental strand, 38943191 - 38943145
Alignment:
| Q |
254 |
ttttctgatgtaaatgtcattgtatatcaattgttgtgacgtgtgtg |
300 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||| ||||| |
|
|
| T |
38943191 |
ttttctgatgtagatgttactgtatatcaattgttgtgacgcgtgtg |
38943145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University