View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7614_low_5 (Length: 227)
Name: NF7614_low_5
Description: NF7614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7614_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 51252828 - 51253031
Alignment:
| Q |
1 |
ttgatttattttcgtgttgattggtacaacattgccggtcttacagtgataatctaaggagggtcacatgcaaacagcattatccctatgagctga--tg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51252828 |
ttgatttattttcgtgttgattggtacaacattgccggtcttacagtgataatctaaggagggtcacatgcaaacagcattatccctatgagctgatgtg |
51252927 |
T |
|
| Q |
99 |
cccaccagatca--ggattcactagacattgtccttacagttgcaaatagtaagactaatttgttaagtgtaaaggaaataataaatggaagaagttatt |
196 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51252928 |
cccaccagatcaggggattcacgagacattgtccttacagttgcaaatagtaagactaatttgttaagtg------------taaatggaagaagttatt |
51253015 |
T |
|
| Q |
197 |
aatacctgaacattat |
212 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51253016 |
aatacctgaacattat |
51253031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University