View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7615_high_16 (Length: 237)

Name: NF7615_high_16
Description: NF7615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7615_high_16
NF7615_high_16
[»] chr1 (2 HSPs)
chr1 (1-237)||(7582929-7583165)
chr1 (33-237)||(7098081-7098285)
[»] chr5 (4 HSPs)
chr5 (40-226)||(17981620-17981806)
chr5 (25-228)||(30202825-30203028)
chr5 (39-146)||(30205267-30205374)
chr5 (47-112)||(30474166-30474231)
[»] chr4 (1 HSPs)
chr4 (61-237)||(13615527-13615703)


Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 7582929 - 7583165
Alignment:
1 tgtctccaatctctaactctactgggttaccgaaattggaaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcg 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7582929 tgtctccaatctctaactctactgggttaccgaaatttgaaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcg 7583028  T
101 atgagcttgagtatttaccagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||    
7583029 atgagcttgagtatttaccagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgttgtaaaaaattaaaatgcttgccagatgg 7583128  T
201 tattagacacctcactgcacttgatttgttgaatatt 237  Q
    |||||||||||||||||||||||||||||||||||||    
7583129 tattagacacctcactgcacttgatttgttgaatatt 7583165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 33 - 237
Target Start/End: Complemental strand, 7098285 - 7098081
Alignment:
33 aaattggaaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagtatttaccagagaaaatatgg 132  Q
    ||||| |||||||||||||||||||| ||||||||||| ||||||||||||| | ||| ||| ||||  |||||||||||||||||||||||||||||||    
7098285 aaatttgaaggagttaccaaatgaacgcttcaacctagctttggagcatctgcaaatctcttgttgctgtgagcttgagtatttaccagagaaaatatgg 7098186  T
133 ggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgcacttgatttgttga 232  Q
    |||||| |||||||||| ||||| |||||||||| ||  ||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
7098185 ggaggtctgcaatcacttcaatctatgaggatttcttattgtgaaagattaaaatgcttgccagatggtattagacacctcaccgcacttgattcgttga 7098086  T
233 atatt 237  Q
     ||||    
7098085 ctatt 7098081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 40 - 226
Target Start/End: Complemental strand, 17981806 - 17981620
Alignment:
40 aaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagtatttaccagagaaaatatggggaggtt 139  Q
    ||||||||||||||||||||||||||||||| |||| |||||||| |||||  ||| |||   ||||||||||||||||||||||||||||||||||||     
17981806 aaggagttaccaaatgaacccttcaacctagctttgaagcatctggatatcaatttgtgcagcgagcttgagtatttaccagagaaaatatggggaggtc 17981707  T
140 tgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgcacttgatt 226  Q
    |||||||||| ||||| |||  ||||  |   ||||  | ||| ||||||||||| || |||||||||||||| |||||||||||||    
17981706 tgcaatcacttcaatctatggtgattgttgattgtaggaaattgaaatgcttgccggacggtattagacaccttactgcacttgatt 17981620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 30203028 - 30202825
Alignment:
25 ggttaccgaaattggaaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagtatttaccagaga 124  Q
    |||| |||||| | ||| ||||||||||||||||||||||  |||| |||||||||||| |||||| ||| ||||   |||||||||  ||||||||||     
30203028 ggtttccgaaaattgaaagagttaccaaatgaacccttcagtctagctttggagcatctaaatatctcttgttgcagcgagcttgagcctttaccagagg 30202929  T
125 aaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgcacttga 224  Q
    |||| ||||||||| | ||||| |||| |   || |  |||  | | ||| |||||||||||||||||| ||| |||||||||||||||||| |||||||    
30202928 aaatttggggaggtctacaatccctacgaaaaataacaattggtggttgtgaaagattaaaatgcttgctagaaggtattagacacctcacttcacttga 30202829  T
225 tttg 228  Q
    ||||    
30202828 tttg 30202825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 146
Target Start/End: Complemental strand, 30205374 - 30205267
Alignment:
39 gaaggagttaccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagtatttaccagagaaaatatggggaggt 138  Q
    ||||||||||||||||||||| || | ||||||| ||||||||||||  ||| |||  || ||||||||||||| ||||||| || |||| |||| ||||    
30205374 gaaggagttaccaaatgaaccatttagcctagttatggagcatctgataatctcttcatgtgatgagcttgagtctttaccaaaggaaatttgggaaggt 30205275  T
139 ttgcaatc 146  Q
     |||||||    
30205274 ctgcaatc 30205267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 112
Target Start/End: Complemental strand, 30474231 - 30474166
Alignment:
47 taccaaatgaacccttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagt 112  Q
    ||||||||||||||||||||||||| ||||||  ||||| |||| ||| ||| | |||||||||||    
30474231 taccaaatgaacccttcaacctagtgttggagtgtctgagtatctcttcttgtggtgagcttgagt 30474166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 61 - 237
Target Start/End: Complemental strand, 13615703 - 13615527
Alignment:
61 ttcaacctagttttggagcatctgaatatcgctttttgcgatgagcttgagtatttaccagagaaaatatggggaggtttgcaatcactacaatccatga 160  Q
    |||||| ||| |||||||||||| ||||||    ||||| | || ||||||||||||||||||||| |||||||||||  ||||||||| ||||| |||     
13615703 ttcaacttagctttggagcatcttaatatccggatttgccacgaacttgagtatttaccagagaaattatggggaggtcggcaatcacttcaatctatgg 13615604  T
161 ggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgcacttgatttgttgaatatt 237  Q
     |||| ||   |||   | |||||||||| || | || |||||||||||||||| ||||||||||| ||||||||||    
13615603 tgattaatcattgtcgtaaattaaaatgcctgtcggacggtattagacacctcattgcacttgattcgttgaatatt 13615527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University