View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7615_low_17 (Length: 257)

Name: NF7615_low_17
Description: NF7615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7615_low_17
NF7615_low_17
[»] chr1 (2 HSPs)
chr1 (135-238)||(14097700-14097803)
chr1 (1-45)||(14099921-14099965)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 135 - 238
Target Start/End: Complemental strand, 14097803 - 14097700
Alignment:
135 taaaaatttactaacttagtttcaaattttgcctactcctaattcttactcaaggtttgggtgtgattaaggtataaattttacaactcctacccggtca 234  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14097803 taaaaatttaccaacttagtttcaaattttgcctacccctaattcttactcaaggtttgggtgtgattaaggtataaattttacaactcctatccggtca 14097704  T
235 tttt 238  Q
    ||||    
14097703 tttt 14097700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 14099965 - 14099921
Alignment:
1 tatattataagcaaagttttaagaaacatagcaccaagacatgtc 45  Q
    ||||||||||||||||||||||||||||||||| |||||||||||    
14099965 tatattataagcaaagttttaagaaacatagcatcaagacatgtc 14099921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University