View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7615_low_20 (Length: 206)
Name: NF7615_low_20
Description: NF7615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7615_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 195
Target Start/End: Complemental strand, 36788172 - 36787998
Alignment:
| Q |
21 |
ccagcttcattaggtcaaatagatccagaaagaatagacttgtcgaggaacaagcttgaaggtgatgcttccgtgcttttcggaagccagaaaaggacac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788172 |
ccagcttcattaggtcaaatagatccagaaagaatagacttgtcgaggaacaagcttgaaggggatgcttccgtgcttttcggaagccagaaaaggacac |
36788073 |
T |
|
| Q |
121 |
aaatacttgatgtttctaggaacttgttgtcttttgatttttctaaggttgattttcctaaacagagtttgatat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788072 |
aaatacttgatgtttctaggaacttgttgtcttttgatttttctaaggttgattttcctaaacagagtttgatat |
36787998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 59 - 181
Target Start/End: Complemental strand, 36779407 - 36779285
Alignment:
| Q |
59 |
cttgtcgaggaacaagcttgaaggtgatgcttccgtgcttttcggaagccagaaaaggacacaaatac-ttgatgtttctaggaacttgttgtcttttga |
157 |
Q |
| |
|
|||||| | ||||| ||||| ||||||||||||||||||||||| ||| | ||||||||| | ||| ||||| |||| ||||||||||| || ||||| |
|
|
| T |
36779407 |
cttgtccaagaacaggcttgtgggtgatgcttccgtgcttttcgggagcaacaaaaggaca-gagtacattgatctttcgaggaacttgttttcgtttga |
36779309 |
T |
|
| Q |
158 |
tttttctaaggttgattttcctaa |
181 |
Q |
| |
|
|||||| || |||||| ||||||| |
|
|
| T |
36779308 |
tttttcaaaagttgatgttcctaa |
36779285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University