View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7617_high_22 (Length: 313)
Name: NF7617_high_22
Description: NF7617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7617_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 58 - 305
Target Start/End: Original strand, 19795321 - 19795564
Alignment:
| Q |
58 |
cacagaagctatcaccaagggaagtttgtgcatattggtaaaatagatgggttaccataagagatgtcaatgtaattttaatataaatttactgttcata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19795321 |
cacagaagctatcaccaagggaagtttgtgcatattggtaaaatagatgggttactataagagatgtcaatgtaatttttctataaatttactgttcata |
19795420 |
T |
 |
| Q |
158 |
tattatgacagaactttattatattaattgatttggcnnnnnnnnnnnnagaaaatttatttggctacacatatctgcnnnnnnnnnnnnngctgtctaa |
257 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19795421 |
tataatgacagaactttattatattaattgatttggc----ttttttttagaaaatttatttggctacacatatctgcaaaaaataaaaaagctgtctaa |
19795516 |
T |
 |
| Q |
258 |
aataatcgagttgtcttcaaatcctgaagtttgagtaacatattcttc |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
19795517 |
aataatcgagttgtcttcaaatcctggagtttgagtaacatatacttc |
19795564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 19794350 - 19794396
Alignment:
| Q |
19 |
atatccaatatggaaaaagcataattttgatggaagttacacagaag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19794350 |
atatccaatatggaaaaagcataattttgatggaagttacacagaag |
19794396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University