View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7617_high_28 (Length: 268)
Name: NF7617_high_28
Description: NF7617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7617_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 10321131 - 10321374
Alignment:
| Q |
13 |
aatataccagtaattaacaaatatgacggtaaaaaaattgtgattttggcnnnnnnnnnnn-tggaaataggattcttttatttgtttatggggttcaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10321131 |
aatataccagtaattaacaaatatgacggtaaaaaaattgtgattttagcaacaaaaaaaaatggaaataggattcttttatttgtttatggggttcaaa |
10321230 |
T |
|
| Q |
112 |
tgattggggggaccgaataaatggggatgttggaagaaggggaggggttggcacat---aaatttgggtcatgggagtgcatgagatgaatgag-aaaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10321231 |
tgattggggggaccgaataaatggggatgttggaagagggggaggggttggcacatggggcatttgggtcatgggagtgcatgagatgaatgagaaaaaa |
10321330 |
T |
|
| Q |
208 |
actccatttttgtgccataaattgcatattgtcattggattatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10321331 |
actccatttttgtgccataaattgcatattgttattggattatt |
10321374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University