View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7617_low_22 (Length: 328)
Name: NF7617_low_22
Description: NF7617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7617_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 14 - 319
Target Start/End: Original strand, 7222924 - 7223221
Alignment:
| Q |
14 |
taatttagccatgttttcccttctcttggctttccttgattttgattcttctgtgttagatttttcatcctccacaacactactgtacgtttgatgaagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7222924 |
taatttagccatgttttcccttctcttggctttccttgattttgattcttctgtgttagatttttcatcctccacaacactactgt----ttgatgaagt |
7223019 |
T |
|
| Q |
114 |
tgacttactataacaccannnnnnnnnnnnnnnnnnnnnaaataaaatccgaactccggtcagccaatgctgtgtaatcgtccaataacnnnnnnnccat |
213 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7223020 |
tgacttgctataacaccaattattatttttattttttt-aaataaaatccgaactccggtcagccaatgcattgtaatcgtccaataacaaaaaaaccat |
7223118 |
T |
|
| Q |
214 |
caacctgccctgtcatacaactaatttcaaaatggaaactatggcgcgtgaaactcgattcacatacctctatgatctaggatgttttttagtatcttct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7223119 |
caacctgccctgtcatacaactaatttcaaaatggaaactat--cgcgtgaaactcgattcacatacctctatgatctaggatg-tttttagtatcttct |
7223215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 11432085 - 11432000
Alignment:
| Q |
14 |
taatttagccatgttttcccttctcttggctttccttgattttgattcttctgtgttagatttttcatcctccacaacactactgt |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
11432085 |
taatttagccctgttttcccttctcttggctttccttgattttgattcttctgtgttagatttttcgtcctccacaacaccactgt |
11432000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University