View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7617_low_38 (Length: 248)
Name: NF7617_low_38
Description: NF7617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7617_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 6 - 168
Target Start/End: Complemental strand, 42823586 - 42823424
Alignment:
| Q |
6 |
tttcgtgttcttatttcctcatcattgtttcagtttttgttgttgatgatataattattcgatttcaatttcgaatggtgtttgatggtgtttcctgctt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42823586 |
tttcgtgttcttatttcctcatcattgtttcagtttttgttgttgatgatacaattattcgatttcaattttgaatggtgtttgatggtgtttcctgctt |
42823487 |
T |
 |
| Q |
106 |
caatggtgttcagtttcaaatttgattatgaattttatttcgaattccttgtgtgtgcgaaac |
168 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42823486 |
caatggtgttcaattttaaatttgattatgaattttatttcgaattccttgtgcgtgcgaaac |
42823424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University