View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7618_high_11 (Length: 419)
Name: NF7618_high_11
Description: NF7618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7618_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 9e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 318 - 401
Target Start/End: Complemental strand, 51116167 - 51116084
Alignment:
| Q |
318 |
atgtgaatttataagtaattatgattaaaatcgaacattttaatttatatgacatttgtttatttattgacactcttaattact |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51116167 |
atgtgaatttataagtaattatgattaaaatcgaacattttaatttatatgacatttgtttatttattgacactcttaattact |
51116084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 51116267 - 51116197
Alignment:
| Q |
9 |
cgtgttggatgatggtaaacctataacagtgcattttcgttaaacttgg-ttaggttgcttactttcgcta |
78 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51116267 |
cgtggtggatgatggtaaacctataacagtgcattttcgttaaacttggtttaggttgcttactttcgcta |
51116197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 315 - 373
Target Start/End: Complemental strand, 51106835 - 51106777
Alignment:
| Q |
315 |
tatatgtgaatttataagtaattatgattaaaatcgaacattttaatttatatgacatt |
373 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||||||||||| ||||| |||| |
|
|
| T |
51106835 |
tatatgtgaatttagaagtaattatgattaaagtcaaacattttaattgatatgtcatt |
51106777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University