View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7618_high_22 (Length: 259)
Name: NF7618_high_22
Description: NF7618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7618_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 4458467 - 4458715
Alignment:
| Q |
1 |
tttccaagctaggcctttgtaatttacatagcccaaacttgagggagggtgttacttaacttaactggttatagttatttacttacactaaccattgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458467 |
tttccaagctaggcctttgtaatttacatagcccaaacttgagggagggtgttacttaacttaactggttatagttatttacttacactaaccattgtta |
4458566 |
T |
|
| Q |
101 |
gttgatttattagttctagttagtacccaaattactacatagatta----nnnnnnnnnnnncacttggtactgttactgattactagaaaaacatttgt |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4458567 |
gttgatttattagttctagttagtatccaaattactacatagattagtgtgtgtgtgtgtgtcacttggtactgttactgattactagaaaaacatttct |
4458666 |
T |
|
| Q |
197 |
acacttttcactttatatttaatatgaagatgagtttattattctctct |
245 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458667 |
acacttttcactctatatttaatatgaagatgagtttattattctctct |
4458715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University