View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7618_high_24 (Length: 248)
Name: NF7618_high_24
Description: NF7618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7618_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 4201228 - 4201417
Alignment:
| Q |
1 |
ccaaatatgtgactgttattagcctaaagttcaagaattggagtggtttagtgaggttatattcatgcggaggtgaaatttgtctgcacaaggtttctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||| | ||||||||| || | | ||||||||| | |
|
|
| T |
4201228 |
ccaaatatgtgactgttattagcctagagttcaagaaatagagtggtttagtgaggttatattcatgctgcagtgaaatttttccgtataaggtttctgc |
4201327 |
T |
 |
| Q |
101 |
tcttttttaaatctgctatgtaaggctacattataaggctggtgctacagctttaagcttggcatgagtctgcacaattgtagaagtttt |
190 |
Q |
| |
|
| |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4201328 |
acatttttaaatctgctatgtttggctacatcataaggctggtgctacagctttaagcttggcatgagtctgcacaactgcagaagtttt |
4201417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University