View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7618_low_22 (Length: 309)
Name: NF7618_low_22
Description: NF7618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7618_low_22 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 190 - 309
Target Start/End: Original strand, 490406 - 490524
Alignment:
| Q |
190 |
ccttctgtggtgaaggaagtaacttttgtcattcagaacatctagtttctaataaatgtcattttctttatctccatttctttcttctccgtggtgaata |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
490406 |
ccttctgtggtgaaggaagtaacttttgtcattcagaacatctagtttctaataaatgtcattttctttatctccatttctttcttttctgtggtgaata |
490505 |
T |
|
| Q |
290 |
tatatttgatggatcatatt |
309 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
490506 |
tatatttgat-gatcatatt |
490524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 490234 - 490306
Alignment:
| Q |
18 |
cttcaaaatggtcctttgttcagtatatattctgagcataggatgaagattattgaaactttcaaacttatga |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490234 |
cttcaaaatggtcctttgttcagtatatattctgagcataggatgaagattattgaaactttcaaacttatga |
490306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University