View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7618_low_36 (Length: 234)
Name: NF7618_low_36
Description: NF7618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7618_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 78 - 222
Target Start/End: Original strand, 30214638 - 30214782
Alignment:
| Q |
78 |
ttttttctcagttttgaacttttctgtgacgtaaaatgcaccaaatgaatgatcttacaattaattcaagttgaatattgtgtctacattcaatgacaac |
177 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30214638 |
ttttctctcagttttgaacttttctgtgacgtaaaatgcaccaaatcaatgatcttacaattaattccagttgaatattgtgtctgcattcaatgacaac |
30214737 |
T |
|
| Q |
178 |
tatacatacatagcttcagtcagccccttcgtccgttcttctcac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30214738 |
tatacatacatagcttcagtcagccccttcgtccgttcttttcac |
30214782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 30214560 - 30214613
Alignment:
| Q |
25 |
caggagcacatttggacatttgcacactcaaccctattaattaaattcagacat |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30214560 |
caggagcacatttggacatttgcacactcaactctattaattaaattcagacat |
30214613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University