View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7619_high_9 (Length: 232)
Name: NF7619_high_9
Description: NF7619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7619_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 43933640 - 43933436
Alignment:
| Q |
10 |
gaagaatatgcattggttaaaagaaatttctaacaatgtgaggtcagggagaagactttcactaggtgaatacaagagagctgtgtcatggtcaaagtat |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933640 |
gaagaatttgcattggttaaaagaaatttctaacaatgtgaggtctgggagaagactttcactaggtgaatacaagagagctgtgtcatggtcaaagtat |
43933541 |
T |
 |
| Q |
110 |
ctaacctcctctggagcagccataaagggaaatgaacaagatgattggaatgctgatatgtctcagttattcattggtgccaaatttgattctgggagac |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933540 |
ctaacttcctctggagcagccataaagggaaatgaacaagatgattggaatgctgatatgtctcagttattcattggtgccaaatttgattctgggagac |
43933441 |
T |
 |
| Q |
210 |
atagc |
214 |
Q |
| |
|
||||| |
|
|
| T |
43933440 |
atagc |
43933436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 35133196 - 35133120
Alignment:
| Q |
33 |
aaatttctaacaatgtgaggtcagggagaagactttcactaggtgaatacaagagagctgtgtcatggtcaaagtat |
109 |
Q |
| |
|
|||||||||||| || | ||| ||||| ||||||||||| ||||| ||||| ||||| ||||| |||||||||||| |
|
|
| T |
35133196 |
aaatttctaacagtggaaagtctgggaggagactttcacttggtgagtacaaaagagcagtgtcttggtcaaagtat |
35133120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University