View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7621_high_2 (Length: 338)
Name: NF7621_high_2
Description: NF7621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7621_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 33893524 - 33893857
Alignment:
| Q |
1 |
catgtggatatgatatctactaattactttattacatgtgatgtttggtgcatttatcgaatttatcgtcaagccgttacatggtcgttttaagtaaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33893524 |
catgtggatatgatatctactaattactttattacatgtgatgtttggtacatttatcgaatttatcgtcaagccgttacatggtcgttttaagtacaac |
33893623 |
T |
 |
| Q |
101 |
atcgatgcttctttcttattttatatgaatcatgttagaatatgtatgtgcataagagatgatgatatcatgtttgtccttgcnnnnnnnnnncatttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | |
|
|
| T |
33893624 |
atcgatgcttctttcttattttatatgaatcatgttagaatatgtatgtgcataagagatgatga-atcatgtttgtccttgc---aaaaaaacattttt |
33893719 |
T |
 |
| Q |
201 |
ttttctcccgtttgtaatgttgatgtgggggaagctctcaacctcttctatgctctccattgttgggtttacgatctacatcataaannnnnnnattttg |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
33893720 |
ttttctcccgtttgtaatgtttatgtgggggaagctctcaacctcttctacgctctccattgctggttttacgatctacatcataaatttttttattttg |
33893819 |
T |
 |
| Q |
301 |
ttcttgactcgnnnnnnnttgttgtatgcttcaacaat |
338 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
33893820 |
ttcttgactcgaaaaaaattgttgtatgcttcaacaat |
33893857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University