View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7621_high_7 (Length: 279)
Name: NF7621_high_7
Description: NF7621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7621_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 91 - 162
Target Start/End: Original strand, 4608244 - 4608315
Alignment:
| Q |
91 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608244 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
4608315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 261
Target Start/End: Original strand, 4608379 - 4608414
Alignment:
| Q |
226 |
gagcctctctctgataactttctgtgacatcttttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608379 |
gagcctctctctgataactttctgtgacatcttttt |
4608414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 4608154 - 4608187
Alignment:
| Q |
1 |
tttgtctctaattcttgtctctttactatgtagg |
34 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
4608154 |
tttgtctctaattcttgtctctttaccatgtagg |
4608187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 135
Target Start/End: Original strand, 4608159 - 4608203
Alignment:
| Q |
91 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaa |
135 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
4608159 |
ctctaattcttgtctctttaccatgtaggtgttttagattttgaa |
4608203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University