View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7621_low_10 (Length: 260)
Name: NF7621_low_10
Description: NF7621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7621_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 167
Target Start/End: Original strand, 4607939 - 4608087
Alignment:
| Q |
19 |
ttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgacagtgattttttagattgttat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4607939 |
ttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgccagtgattttttagattgttat |
4608038 |
T |
 |
| Q |
119 |
tgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608039 |
tgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
4608087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 212 - 249
Target Start/End: Original strand, 4608132 - 4608169
Alignment:
| Q |
212 |
cctatgattaatgttattatgttttgtctctaattctt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608132 |
cctatgattaatgttattatgttttgtctctaattctt |
4608169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University