View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7622_high_9 (Length: 301)
Name: NF7622_high_9
Description: NF7622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7622_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 86 - 289
Target Start/End: Original strand, 28691366 - 28691569
Alignment:
| Q |
86 |
tgacacaatgaaatgtttggtatagattggaaatgctttattggatgatgaaacagatcaaaaaggtatgatagaatatgcatgggagcatgcagtaata |
185 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
28691366 |
tgacacaatgaaatgtttggtacagattggaaatgctttattggatgatgaaacagatcaaaaaggtatgatagagtatgcatgggaccatgcagtaata |
28691465 |
T |
 |
| Q |
186 |
tctgatggtttataccataacatcacaaccatatgcaacttcagccatccaattcaaaatcaaacagatgaatgcaatacagaacttaataaatactttg |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28691466 |
tctgatggtttatatcataacatcacaaccatatgcaacttcagccatccaattcaaaatcaaacagatgaatgcaatacagaacttaataaatacttcg |
28691565 |
T |
 |
| Q |
286 |
atgt |
289 |
Q |
| |
|
|||| |
|
|
| T |
28691566 |
atgt |
28691569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University