View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7622_low_11 (Length: 259)
Name: NF7622_low_11
Description: NF7622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7622_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 2 - 251
Target Start/End: Complemental strand, 13923397 - 13923148
Alignment:
| Q |
2 |
agcctctatcccatgcttgatacattcactgaagtgtgactggtatttatctggttcatcttccatcaacacctacaatgaataccgtaaagtataaagg |
101 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13923397 |
agcctctatcccatgcttgatatattcactgaagtgcgactggtatttatctggttcatcttccatcaacacctacaatgaataccataaagtataaagg |
13923298 |
T |
 |
| Q |
102 |
ttgtaaccaaaatttctagatacctttataatgaatgcacaaaaaataaggagaacaaagtacaattttcccacttgccttcatatagtaagcaacatgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13923297 |
ttgtaaccaaaatttctagatacctttataaagaatgcactaaaaataaggagaacaaagtacaattttcccacttgccttcatatagtaagcaacatgt |
13923198 |
T |
 |
| Q |
202 |
ccaccgaagatatttttacggcgagcctcaacatcaagctttttcttctc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13923197 |
ccaccgaagatatttttacggcgagcctcagcatcaagctttttcttctc |
13923148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University