View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7622_low_13 (Length: 250)
Name: NF7622_low_13
Description: NF7622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7622_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 43 - 240
Target Start/End: Original strand, 28691642 - 28691830
Alignment:
| Q |
43 |
ttctttttccaaattggtactggtgagttaattcatcaatttagaacttaaaaactagtacacgtatactacagcaactaaagttacttgcctattgaaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
28691642 |
ttctttttccaaattggtactggtgagtt---tcatcaatttagaacttaaaaactagtacac------tactgcaactaacgttacttgcctattgaaa |
28691732 |
T |
|
| Q |
143 |
ttgtcgattttaataggacgggtggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccacaggttc |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28691733 |
ttgtcaattttaataggacgggtggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccagaggttc |
28691830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University