View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7622_low_14 (Length: 249)
Name: NF7622_low_14
Description: NF7622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7622_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 15 - 249
Target Start/End: Complemental strand, 35800675 - 35800441
Alignment:
| Q |
15 |
aattataaattagaatagaaagaattgaggtatatatgagcgcccaagcacatgcgacatttcaagtgagagtctttaatgtcagattgaggagtaaacc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800675 |
aattataaattagaatagaaagaattgaggtatatatgagcacccaagcacatgcgacatttcaagtgagagtctttaatgtcagattgaggagtaaacc |
35800576 |
T |
 |
| Q |
115 |
ataatcatttgatcataaatatacaaaagaaatatagtttaatcaacttcaagctgaacgcataacaatcaacataagattattttggcaggattctatt |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800575 |
ataatcatttgatcatagatatacaaaagaaatatagtttaatcaacttcaagctgaacgcataacaatcaacataagattattttggcaggattctatt |
35800476 |
T |
 |
| Q |
215 |
caatttccatttcatgcagactagcgcttgtattc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800475 |
caatttccatttcatgcagactagcgcttgtattc |
35800441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University