View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7623_high_13 (Length: 245)
Name: NF7623_high_13
Description: NF7623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7623_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 52982874 - 52982650
Alignment:
| Q |
3 |
gtgatctgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatcgaaagttggttggcttggctgggatct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52982874 |
gtgatctgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatcgaaagttggttggcttggctgggatcg |
52982775 |
T |
 |
| Q |
103 |
ctgcgaaaaatcgtgggagcggtggaatcgtgcaaacatgttgtttccattattgggtttctcagatatattttcgagggtcgggtctgcggcccagttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52982774 |
ctgcgaaaaatcgtgggagcggtggaatcgtgcaaacatgtcgtttccattattgggtttctcagatatattttcgagggtcgggtctgcagcccagttc |
52982675 |
T |
 |
| Q |
203 |
attaacagcgccttttgggatttaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52982674 |
attaacagcgccttttgggatttaa |
52982650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 55618991 - 55618926
Alignment:
| Q |
10 |
gaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc |
75 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||| |||||||| |||||||||| | |||||||| |
|
|
| T |
55618991 |
gaaacgtaagatcgtacgctactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc |
55618926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 55626295 - 55626230
Alignment:
| Q |
10 |
gaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc |
75 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||| |||||||| |||||||||| | |||||||| |
|
|
| T |
55626295 |
gaaacgtaagatcgtacgctactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc |
55626230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 55657341 - 55657275
Alignment:
| Q |
9 |
tgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc |
75 |
Q |
| |
|
|||||| ||||||||||| || |||||||| |||| |||||||| |||||||||| | |||||||| |
|
|
| T |
55657341 |
tgaaacgtaagatcgtacactactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc |
55657275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 227
Target Start/End: Complemental strand, 7737104 - 7736986
Alignment:
| Q |
107 |
gaaaaatcgtgggagcggtggaatcgtgcaaacatgttgtttccattattgggtttctcagatatattttcgagggtcgggtctgcggcccagttcatta |
206 |
Q |
| |
|
||||||||||||||||||||||||| || || ||| | |||| |||||||||||||||||||| |||| | || ||||||| ||| ||||||||||| |
|
|
| T |
7737104 |
gaaaaatcgtgggagcggtggaatcatgtgaatctgtcgattcctttattgggtttctcagatatgtttt-gtggatcgggtcagcgacccagttcattg |
7737006 |
T |
 |
| Q |
207 |
acagcgccttttgggatttaa |
227 |
Q |
| |
|
| || ||||||||||||||| |
|
|
| T |
7737005 |
a-tgcaccttttgggatttaa |
7736986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 24021014 - 24020959
Alignment:
| Q |
152 |
ttattgggtttctcagatatattttcgagggtcgggtctgcggcccagttcattaa |
207 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| ||||||| | ||| ||||||||| |
|
|
| T |
24021014 |
ttattgggtttctcagatatgttttcgtgggtagggtctgtgacccggttcattaa |
24020959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University