View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7623_high_6 (Length: 363)
Name: NF7623_high_6
Description: NF7623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7623_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 16 - 340
Target Start/End: Original strand, 36844222 - 36844546
Alignment:
| Q |
16 |
aacctgtgagaatgaggctttttatattcatcgctccgaattcgggttcggtttcgggttctcaacctgatccccttaaacctaattccaacgttgattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
36844222 |
aacctgtgagaatgaggctttttatattcatcgctccgaattcgggttcggtttcggcttctcaacctgatccacttaaacctaattccaaagttgattt |
36844321 |
T |
 |
| Q |
116 |
tctctttggtattgagaataaaaccctagctcaaccgattcaaccttcgtatgctgctgtcactgccaagtatcacgatcctgtgccggatcttgttgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36844322 |
tctctttggtattgagaataaaaccctagctcaaccgattcaaccttcgtatgctgctgtgactgccaagtatcacgatcctgtgccggatcttgttgct |
36844421 |
T |
 |
| Q |
216 |
ccacaaccggactatccaccacgtggatctaccgatgagagtgtagagattcagagacagttacagcgtttgcaggtttctgagagtgagcagtctctat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36844422 |
ccacaaccggactatccaccacgtggatctaccgatgagagtgtagagattcagagacagttacagcgtttgcaggtttctgagagtgagcagtctctat |
36844521 |
T |
 |
| Q |
316 |
atcggagaagttcggatggtgttac |
340 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36844522 |
atcggagaagttcggatggtgttac |
36844546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University