View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7623_low_10 (Length: 354)
Name: NF7623_low_10
Description: NF7623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7623_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 111 - 340
Target Start/End: Original strand, 35182245 - 35182471
Alignment:
| Q |
111 |
gttaaactaggtcgggactgggcctatcacacatactccccacataagcattttgcacgtaccatcatgcatttggcacacacctaagtgcgccctacag |
210 |
Q |
| |
|
||||||||||||||| || || |||| ||||||| |||||| ||| ||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
35182245 |
gttaaactaggtcggttcttggtctataacacataatccccatatatgcattttgcacgtaccatcatgcatttggcaca------agtgcgcccttcag |
35182338 |
T |
 |
| Q |
211 |
tagccaactctagtccacgatgctcattaaagaggtgagattgcaacgttaattaatggtcaaatgatttgag---tcatcgattttgtaaccgatcttg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
35182339 |
tagccaactctagtccacgatgctcattaaagaggtgagattgcaacgttaattaatggtcaaatgatttgagtcatcatcggttttgtaaccgatcttg |
35182438 |
T |
 |
| Q |
308 |
gctccttgcctgtttaaaaacctcgtctccctc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35182439 |
gctccttgcctgtttaaaaacctcgtctccctc |
35182471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University