View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7623_low_17 (Length: 245)

Name: NF7623_low_17
Description: NF7623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7623_low_17
NF7623_low_17
[»] chr4 (4 HSPs)
chr4 (3-227)||(52982650-52982874)
chr4 (10-75)||(55618926-55618991)
chr4 (10-75)||(55626230-55626295)
chr4 (9-75)||(55657275-55657341)
[»] chr8 (1 HSPs)
chr8 (107-227)||(7736986-7737104)
[»] chr1 (1 HSPs)
chr1 (152-207)||(24020959-24021014)


Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 52982874 - 52982650
Alignment:
3 gtgatctgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatcgaaagttggttggcttggctgggatct 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
52982874 gtgatctgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatcgaaagttggttggcttggctgggatcg 52982775  T
103 ctgcgaaaaatcgtgggagcggtggaatcgtgcaaacatgttgtttccattattgggtttctcagatatattttcgagggtcgggtctgcggcccagttc 202  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
52982774 ctgcgaaaaatcgtgggagcggtggaatcgtgcaaacatgtcgtttccattattgggtttctcagatatattttcgagggtcgggtctgcagcccagttc 52982675  T
203 attaacagcgccttttgggatttaa 227  Q
    |||||||||||||||||||||||||    
52982674 attaacagcgccttttgggatttaa 52982650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 55618991 - 55618926
Alignment:
10 gaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc 75  Q
    ||||| ||||||||||||||  |||||||| |||| |||||||| |||||||||| | ||||||||    
55618991 gaaacgtaagatcgtacgctactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc 55618926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 55626295 - 55626230
Alignment:
10 gaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc 75  Q
    ||||| ||||||||||||||  |||||||| |||| |||||||| |||||||||| | ||||||||    
55626295 gaaacgtaagatcgtacgctactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc 55626230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 55657341 - 55657275
Alignment:
9 tgaaacataagatcgtacgcttatacagtctagccaacccttggcatgctcgtgtatgtctggaatc 75  Q
    |||||| ||||||||||| ||  |||||||| |||| |||||||| |||||||||| | ||||||||    
55657341 tgaaacgtaagatcgtacactactacagtcttgccaccccttggcgtgctcgtgtacgactggaatc 55657275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 227
Target Start/End: Complemental strand, 7737104 - 7736986
Alignment:
107 gaaaaatcgtgggagcggtggaatcgtgcaaacatgttgtttccattattgggtttctcagatatattttcgagggtcgggtctgcggcccagttcatta 206  Q
    ||||||||||||||||||||||||| ||  ||  ||| | |||| |||||||||||||||||||| |||| | || ||||||| ||| |||||||||||     
7737104 gaaaaatcgtgggagcggtggaatcatgtgaatctgtcgattcctttattgggtttctcagatatgtttt-gtggatcgggtcagcgacccagttcattg 7737006  T
207 acagcgccttttgggatttaa 227  Q
    |  || |||||||||||||||    
7737005 a-tgcaccttttgggatttaa 7736986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 24021014 - 24020959
Alignment:
152 ttattgggtttctcagatatattttcgagggtcgggtctgcggcccagttcattaa 207  Q
    |||||||||||||||||||| |||||| |||| ||||||| | ||| |||||||||    
24021014 ttattgggtttctcagatatgttttcgtgggtagggtctgtgacccggttcattaa 24020959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University