View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7625_low_5 (Length: 250)
Name: NF7625_low_5
Description: NF7625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7625_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 90 - 239
Target Start/End: Complemental strand, 55060688 - 55060538
Alignment:
| Q |
90 |
ggaaatctgtttatgaatcaagaacatggtttggtgaaatattggctactaa-gagttctgttgattgtgatgttgttatagttgttcctgattgtggtg |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55060688 |
ggaaatctgtttatgaatcaagaagatggtttggtgaaatattggctactaaagagtcctgttgattgtgatgttgttatagttgttcctgattttggtg |
55060589 |
T |
|
| Q |
189 |
ttgttgctgcacttggttatgctgcaaaagttggtgttccttttccacagg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
55060588 |
ttgttgctgcacttggttatgctgcaaaagctggtgttccttttcaacagg |
55060538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 233
Target Start/End: Complemental strand, 27356828 - 27356729
Alignment:
| Q |
134 |
gctactaagagttctgttgattgtgatgttgttatagttgttcctgattgtggtgttgttgctgcacttggttatgctgcaaaagttggtgttccttttc |
233 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||| ||||||||||| ||||||||| ||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
27356828 |
gctactgagagtcctgttgattgtgatgttgtgatagctgttcctgattctggtgttgtggctgctcttggttatgctgcgaaagctggtgttccttttc |
27356729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University