View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7626_high_11 (Length: 285)
Name: NF7626_high_11
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7626_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 40157051 - 40157300
Alignment:
| Q |
20 |
tttacagatatatttatctatgttgacatacatgaagtagagttggataatttagtgaatgagattgcataataacgatgtcaagctaaagaaatattgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40157051 |
tttacagatatatttatctatgttgacatacatgaagtagagttggataatttagtgaatgagattgcataataacgatgtcaagctaaagaaatattgt |
40157150 |
T |
|
| Q |
120 |
ggtgagcaaagattctgaatcttgtctagtaaagaattggaaagagctcatttgagtttgattattattcatcgtctcatctttatcgttgacccttttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40157151 |
ggtgagcaaagattctgaatcttgtctagtaaagaattggaaagagctcatttgagtttgattattattcatcgtctcatctttatcgttgacccttttt |
40157250 |
T |
|
| Q |
220 |
ctgcnnnnnnntaagggatatgaattgctgggttaatggtcatcgtgtgtg |
270 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40157251 |
ctgc-ggggggtaagggatatgaattgctgggttaatggtcattgtgtgtg |
40157300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University