View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7626_high_7 (Length: 365)
Name: NF7626_high_7
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7626_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 9 - 343
Target Start/End: Original strand, 36937746 - 36938080
Alignment:
| Q |
9 |
caacaatattaacacccattcctaaatccttaacctgatactcagcataaccaccaggcctaaaatccttatttatcatcctcttcccaaacaactccaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36937746 |
caacaaaattaacacccattcctaaatccttaacctgatactcagcataaccaccaggcctaaaatccttatttatcatcctcttcccaaacaactccaa |
36937845 |
T |
 |
| Q |
109 |
tgcctttgtacccgcggcaccattcttaatcgcatccaaaaattgctccaagtcaagcccacttcgtttcgcaaacactaatccttcgctaagtcccatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36937846 |
tgcctttgtacccgcggcaccattcttaatcgcatccaaaaattgctccaagtcaatcccacttcgtttcgcaaacactaatccttcgctaagtccgatc |
36937945 |
T |
 |
| Q |
209 |
aaatttgctccgatcgttatctgattcgctatcttgcaactctgtccgcaccctgcaggccccaggtatgttgcttttcccattatttcaaacaacggtt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36937946 |
aaatttgctccgatcgttatctgattcgctatcttgcaactctgtccgcaccctgcaggccccaggtatgttgcttttcccattatttcaaacaacggtt |
36938045 |
T |
 |
| Q |
309 |
gtagccattcaactacagcggcttcgcctgctgcg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938046 |
gtagccattcaactacagcggcttcgcctgctgcg |
36938080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University