View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7626_low_17 (Length: 235)
Name: NF7626_low_17
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7626_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 38047764 - 38047563
Alignment:
| Q |
17 |
atcaaggtgagtttaacgaaatcacagtaaaattatgattttgttgaagttctaaagtatagtttttgttagaatcatcatggtttactatgatttcgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
38047764 |
atcaaggtgagtttaacgaaatcacagtaaaattatgattttgttgaagttctaaagtatagtttttgttagaatcattgttgtttactatgatttcgtc |
38047665 |
T |
|
| Q |
117 |
aaactcattgataacatatgacacaaatgtttatcaatattctcctattttaaaaccttgtttgtatatgttggttattattatgcaagtagtagctatc |
216 |
Q |
| |
|
||| ||||||||||||| |||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38047664 |
aaattcattgataacatgtgacgcaa--gtttatcagtattctcctattttaaaaccttgtttgtatatgttggttattattatgcaagtagtagctatc |
38047567 |
T |
|
| Q |
217 |
tttt |
220 |
Q |
| |
|
|||| |
|
|
| T |
38047566 |
tttt |
38047563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University