View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7626_low_18 (Length: 233)
Name: NF7626_low_18
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7626_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 6030694 - 6030486
Alignment:
| Q |
1 |
aaaacaatgaaagtaatgcaattttcattgctgtctactgtgagtctcaaccagtgtagtcatattaatttactggttctttgtccttcacttttgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6030694 |
aaaacaatgaaagtaatgcaattttcattgctgtctactgtgagtctcaaccagtgtagtcatattaatttactggttctttgtccttcacttttgtaaa |
6030595 |
T |
 |
| Q |
101 |
atagtatagcagtaagacactagagaactttagcaaattatttataaccagaagtcggtagaggtacaaacaccaaacaaattcataccataaaagttac |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
6030594 |
ata-agtagcagtaagacactagagaactttagcaaattatttataaccagaagtcggtagaggtacaaacaccaaacagattcataccataaaagttgc |
6030496 |
T |
 |
| Q |
201 |
atttattagg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
6030495 |
atttattagg |
6030486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University