View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7626_low_19 (Length: 229)

Name: NF7626_low_19
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7626_low_19
NF7626_low_19
[»] chr7 (2 HSPs)
chr7 (7-134)||(2493988-2494115)
chr7 (179-229)||(2493899-2493949)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 2494115 - 2493988
Alignment:
7 gaaggtggagttgttggagtaactgttcgtgctaatggttcatcatcttcttcttaatctttaattaatgtaataaataaagtaattagatagatttaag 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2494115 gaaggtggagttgttggagtaactgttcgtgctaatggttcatcatcttcttcttaatctttaattaatgtaataaataaagtaattagatagatttaag 2494016  T
107 tactatgttacttggttaattaattagc 134  Q
    |||||||| |||||||||||||||||||    
2494015 tactatgtaacttggttaattaattagc 2493988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 2493949 - 2493899
Alignment:
179 tgctatgagatattatgaattatgaatgaggaattatcatcacctttgtta 229  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||    
2493949 tgctatgagatattatgaattatgaatgaggaattatgatcacctttgtta 2493899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University