View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7626_low_19 (Length: 229)
Name: NF7626_low_19
Description: NF7626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7626_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 2494115 - 2493988
Alignment:
| Q |
7 |
gaaggtggagttgttggagtaactgttcgtgctaatggttcatcatcttcttcttaatctttaattaatgtaataaataaagtaattagatagatttaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494115 |
gaaggtggagttgttggagtaactgttcgtgctaatggttcatcatcttcttcttaatctttaattaatgtaataaataaagtaattagatagatttaag |
2494016 |
T |
|
| Q |
107 |
tactatgttacttggttaattaattagc |
134 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
2494015 |
tactatgtaacttggttaattaattagc |
2493988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 2493949 - 2493899
Alignment:
| Q |
179 |
tgctatgagatattatgaattatgaatgaggaattatcatcacctttgtta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2493949 |
tgctatgagatattatgaattatgaatgaggaattatgatcacctttgtta |
2493899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University