View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7627_low_6 (Length: 211)
Name: NF7627_low_6
Description: NF7627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7627_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 196
Target Start/End: Original strand, 53478660 - 53478846
Alignment:
| Q |
10 |
aagaatatgcttaccctttcactgcttcaaaagtggagcagctagagaaacaacttgaagaagaggctaaggatcttccaaatttggtgcatcatgaagg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53478660 |
aagaaaatgcttaccctttcactgcttcaaaagtggagcagctagagaaacaacttgaagaagaggctaaggatcttccaaatttggtgcatcatgaagg |
53478759 |
T |
 |
| Q |
110 |
gcaccatcatggacttaatttagtgtctgatggaaatgggggagggcccttcatttgttgtgtctgtgatgaacaagggtctaattg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53478760 |
gcaccatcatggacttaatttagtgtctgatggaaatgggggagggcccttcatttgttgtgtctgtgatgaacaagggtctaattg |
53478846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University